ID: 1105415013_1105415021

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1105415013 1105415021
Species Human (GRCh38) Human (GRCh38)
Location 13:20203795-20203817 13:20203830-20203852
Sequence CCTTCTCCCAGCTATCCCTTTCA AAAGCCTGGGGTATCTATTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 400} {0: 1, 1: 0, 2: 2, 3: 11, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!