ID: 1105421510_1105421512

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1105421510 1105421512
Species Human (GRCh38) Human (GRCh38)
Location 13:20256414-20256436 13:20256451-20256473
Sequence CCCGGTTGTTCTTAATGAACTCT CTCTTCCTGATATAAATGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 139} {0: 1, 1: 0, 2: 0, 3: 6, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!