ID: 1105422629_1105422639

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1105422629 1105422639
Species Human (GRCh38) Human (GRCh38)
Location 13:20266483-20266505 13:20266532-20266554
Sequence CCTGGGAGAAGTGGAGAAGTTGG GGGTCTCATCCACCACCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 318} {0: 1, 1: 0, 2: 1, 3: 9, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!