ID: 1105438119_1105438124

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1105438119 1105438124
Species Human (GRCh38) Human (GRCh38)
Location 13:20394631-20394653 13:20394661-20394683
Sequence CCTGAGCGCGCGCGGACACACAC GGCCCTGTGAGGACGCGGCGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 56, 4: 203} {0: 1, 1: 0, 2: 3, 3: 25, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!