ID: 1105441207_1105441218

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1105441207 1105441218
Species Human (GRCh38) Human (GRCh38)
Location 13:20416455-20416477 13:20416491-20416513
Sequence CCTGCCCTCTCTCCAGGCTGCTG GTGGCCCCTCGCACCCCCGTGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 11, 3: 106, 4: 912} {0: 1, 1: 0, 2: 0, 3: 1, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!