ID: 1105444163_1105444168

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1105444163 1105444168
Species Human (GRCh38) Human (GRCh38)
Location 13:20438162-20438184 13:20438202-20438224
Sequence CCATGCAGCTATGTAAATGGTGG CTTAGCACATAAAACCTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121} {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!