ID: 1105567125_1105567132

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1105567125 1105567132
Species Human (GRCh38) Human (GRCh38)
Location 13:21560679-21560701 13:21560721-21560743
Sequence CCCCATTGGGATTATTGCAATTA GGGTTACAAACTAGGTCAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 180} {0: 1, 1: 0, 2: 1, 3: 4, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!