ID: 1105573925_1105573927

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1105573925 1105573927
Species Human (GRCh38) Human (GRCh38)
Location 13:21631950-21631972 13:21631964-21631986
Sequence CCTGGGGACCTAAGTTGAAGTTG TTGAAGTTGTTTGTTTCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 59, 4: 234} {0: 1, 1: 0, 2: 3, 3: 46, 4: 510}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!