ID: 1105587473_1105587486

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1105587473 1105587486
Species Human (GRCh38) Human (GRCh38)
Location 13:21758431-21758453 13:21758478-21758500
Sequence CCCCCCCCAAAGCATGCCAACTT CATTTTGCACAATTGGCCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 309} {0: 1, 1: 0, 2: 1, 3: 8, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!