|
Left Crispr |
Right Crispr |
| Crispr ID |
1105640986 |
1105640997 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:22263988-22264010
|
13:22264033-22264055
|
| Sequence |
CCATCTCCAAAAAAAAAAAAAAA |
TTGTGGGTGGGGATGGCGGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2676, 1: 87395, 2: 67301, 3: 106475, 4: 184656} |
{0: 1, 1: 0, 2: 8, 3: 84, 4: 866} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|