ID: 1105650439_1105650447

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1105650439 1105650447
Species Human (GRCh38) Human (GRCh38)
Location 13:22371699-22371721 13:22371739-22371761
Sequence CCCTTCCACCTATAAGCCTACAA TTACTTCCTAGATACAATGGGGG
Strand - +
Off-target summary {0: 2, 1: 17, 2: 190, 3: 1011, 4: 1456} {0: 922, 1: 1520, 2: 1486, 3: 981, 4: 2568}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!