|
Left Crispr |
Right Crispr |
Crispr ID |
1105650439 |
1105650447 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:22371699-22371721
|
13:22371739-22371761
|
Sequence |
CCCTTCCACCTATAAGCCTACAA |
TTACTTCCTAGATACAATGGGGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 17, 2: 190, 3: 1011, 4: 1456} |
{0: 922, 1: 1520, 2: 1486, 3: 981, 4: 2568} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|