ID: 1105658655_1105658657

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1105658655 1105658657
Species Human (GRCh38) Human (GRCh38)
Location 13:22468988-22469010 13:22469006-22469028
Sequence CCTTCTGCTATGTGAAAGCACAG CACAGCAAGAAGATGTGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 186, 4: 884} {0: 1, 1: 0, 2: 2, 3: 15, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!