ID: 1105731192_1105731193

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1105731192 1105731193
Species Human (GRCh38) Human (GRCh38)
Location 13:23218717-23218739 13:23218745-23218767
Sequence CCATGACAGGTATTGTGCTGCTT GTATTAATACAAATAGACCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 116} {0: 1, 1: 0, 2: 0, 3: 14, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!