ID: 1105762330_1105762340

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1105762330 1105762340
Species Human (GRCh38) Human (GRCh38)
Location 13:23526254-23526276 13:23526292-23526314
Sequence CCCCCTTGTGGTCCAGGAGGACA TTTTGAGAATGCATCAGTAAGGG
Strand - +
Off-target summary {0: 2, 1: 41, 2: 157, 3: 120, 4: 270} {0: 31, 1: 44, 2: 109, 3: 118, 4: 387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!