|
Left Crispr |
Right Crispr |
Crispr ID |
1105762330 |
1105762340 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:23526254-23526276
|
13:23526292-23526314
|
Sequence |
CCCCCTTGTGGTCCAGGAGGACA |
TTTTGAGAATGCATCAGTAAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 41, 2: 157, 3: 120, 4: 270} |
{0: 31, 1: 44, 2: 109, 3: 118, 4: 387} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|