ID: 1105769567_1105769573

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1105769567 1105769573
Species Human (GRCh38) Human (GRCh38)
Location 13:23595623-23595645 13:23595642-23595664
Sequence CCTACATTTTATTGGTGTCCCTG CCTGAAAGTGACGGGGAGAATGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 201, 3: 407, 4: 608} {0: 1985, 1: 4644, 2: 2767, 3: 1104, 4: 755}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!