ID: 1105802696_1105802699

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1105802696 1105802699
Species Human (GRCh38) Human (GRCh38)
Location 13:23922654-23922676 13:23922675-23922697
Sequence CCAGACTGGGGCACAATTGTGTC TCACACTAAGCTAGATGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 244} {0: 1, 1: 0, 2: 1, 3: 7, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!