ID: 1105805734_1105805744

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1105805734 1105805744
Species Human (GRCh38) Human (GRCh38)
Location 13:23950808-23950830 13:23950844-23950866
Sequence CCCCCAGGAGGACTGAGCCCCTT GCCCCTTCCAGGCCAGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 197} {0: 1, 1: 1, 2: 6, 3: 89, 4: 735}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!