ID: 1105832678_1105832691

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1105832678 1105832691
Species Human (GRCh38) Human (GRCh38)
Location 13:24178098-24178120 13:24178150-24178172
Sequence CCCACCTTGGCCTCCCAAAGTGC GGCTTGATTGTTTTTTAAACTGG
Strand - +
Off-target summary {0: 28733, 1: 128252, 2: 230554, 3: 215949, 4: 130370} {0: 1, 1: 0, 2: 0, 3: 41, 4: 476}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!