ID: 1105878925_1105878940

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1105878925 1105878940
Species Human (GRCh38) Human (GRCh38)
Location 13:24586505-24586527 13:24586554-24586576
Sequence CCTGACGCCCAGTGATCTGCCCA ACAGGCGGGAGCCACCATGATGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 161, 3: 6136, 4: 25424} {0: 4, 1: 8, 2: 296, 3: 1606, 4: 4464}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!