|
Left Crispr |
Right Crispr |
Crispr ID |
1105878930 |
1105878940 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:24586525-24586547
|
13:24586554-24586576
|
Sequence |
CCACCTCGGCCTCCCAAAGTGCT |
ACAGGCGGGAGCCACCATGATGG |
Strand |
- |
+ |
Off-target summary |
{0: 87986, 1: 182858, 2: 138884, 3: 74939, 4: 51691} |
{0: 4, 1: 8, 2: 296, 3: 1606, 4: 4464} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|