ID: 1105878930_1105878940

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1105878930 1105878940
Species Human (GRCh38) Human (GRCh38)
Location 13:24586525-24586547 13:24586554-24586576
Sequence CCACCTCGGCCTCCCAAAGTGCT ACAGGCGGGAGCCACCATGATGG
Strand - +
Off-target summary {0: 87986, 1: 182858, 2: 138884, 3: 74939, 4: 51691} {0: 4, 1: 8, 2: 296, 3: 1606, 4: 4464}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!