ID: 1105887382_1105887387

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1105887382 1105887387
Species Human (GRCh38) Human (GRCh38)
Location 13:24653461-24653483 13:24653489-24653511
Sequence CCTTCCACATTCTGCAGGAGACC AAAAGAAACAGCAGGAATCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 199} {0: 1, 1: 0, 2: 5, 3: 86, 4: 935}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!