ID: 1105898943_1105898955

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1105898943 1105898955
Species Human (GRCh38) Human (GRCh38)
Location 13:24740715-24740737 13:24740753-24740775
Sequence CCCCTCGCCTCTGTGACCTTGGG CCTGTGGAGCCCATTTCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 43, 4: 374} {0: 1, 1: 0, 2: 2, 3: 12, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!