ID: 1105898945_1105898955

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1105898945 1105898955
Species Human (GRCh38) Human (GRCh38)
Location 13:24740716-24740738 13:24740753-24740775
Sequence CCCTCGCCTCTGTGACCTTGGGC CCTGTGGAGCCCATTTCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 63, 4: 376} {0: 1, 1: 0, 2: 2, 3: 12, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!