ID: 1105900171_1105900179

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1105900171 1105900179
Species Human (GRCh38) Human (GRCh38)
Location 13:24746438-24746460 13:24746470-24746492
Sequence CCGTCCTCCTGGTCCTTGCTGTG CGTCACCGCGTTCTCCTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 59, 4: 460} {0: 1, 1: 0, 2: 0, 3: 0, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!