ID: 1105923181_1105923188

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1105923181 1105923188
Species Human (GRCh38) Human (GRCh38)
Location 13:24983860-24983882 13:24983876-24983898
Sequence CCCATGGAGGTTCCTGGAGGGTG GAGGGTGGCGCACCCAGGGAGGG
Strand - +
Off-target summary {0: 3, 1: 9, 2: 7, 3: 33, 4: 174} {0: 4, 1: 31, 2: 91, 3: 192, 4: 546}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!