ID: 1105933346_1105933352

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1105933346 1105933352
Species Human (GRCh38) Human (GRCh38)
Location 13:25073755-25073777 13:25073770-25073792
Sequence CCCCCCTCAAAAAGAGGAAGGAA GGAAGGAATAAAAGAAGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 85, 4: 574} {0: 1, 1: 3, 2: 105, 3: 1164, 4: 7150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!