ID: 1105934285_1105934294

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1105934285 1105934294
Species Human (GRCh38) Human (GRCh38)
Location 13:25084963-25084985 13:25084997-25085019
Sequence CCCTTCCTTGGTAGCAGTTGTCT TCAGGATCTGGCTGGGTTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 239} {0: 1, 1: 0, 2: 1, 3: 12, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!