ID: 1105957706_1105957711

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1105957706 1105957711
Species Human (GRCh38) Human (GRCh38)
Location 13:25300291-25300313 13:25300321-25300343
Sequence CCATGGGCGACCCACCAAGGTGA TAAATTGAATTACCTCCCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 68} {0: 1, 1: 5, 2: 19, 3: 211, 4: 1024}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!