ID: 1105964465_1105964478

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1105964465 1105964478
Species Human (GRCh38) Human (GRCh38)
Location 13:25372119-25372141 13:25372164-25372186
Sequence CCACCCATGGTCCTCGGGCGGCG GTAGCCTCCGTCTCTCGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 55} {0: 1, 1: 0, 2: 1, 3: 85, 4: 2665}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!