ID: 1106020448_1106020461

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1106020448 1106020461
Species Human (GRCh38) Human (GRCh38)
Location 13:25909796-25909818 13:25909849-25909871
Sequence CCCGCCGCCCTCCCCCAACTCAG TCTGTGAATTTACCTATTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 74, 4: 662} {0: 4, 1: 30, 2: 194, 3: 581, 4: 1484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!