ID: 1106030415_1106030418

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1106030415 1106030418
Species Human (GRCh38) Human (GRCh38)
Location 13:25997076-25997098 13:25997104-25997126
Sequence CCCAAAGTGCTGGGATTACAGGT CCACCGTGCCCCCACCTTATAGG
Strand - +
Off-target summary {0: 71908, 1: 300079, 2: 246221, 3: 151210, 4: 174122} {0: 1, 1: 0, 2: 0, 3: 8, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!