ID: 1106031466_1106031474

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1106031466 1106031474
Species Human (GRCh38) Human (GRCh38)
Location 13:26009393-26009415 13:26009417-26009439
Sequence CCCCAGCTCTGCCCTGCACTGAG GCATCTGCGCACGTGTGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 75, 4: 603} {0: 1, 1: 0, 2: 1, 3: 15, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!