ID: 1106105887_1106105888

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1106105887 1106105888
Species Human (GRCh38) Human (GRCh38)
Location 13:26733231-26733253 13:26733260-26733282
Sequence CCTTGATTTTCTTTTCTTTTACT CTAAATATACAAGTAGACAATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 33, 3: 515, 4: 4531} {0: 1, 1: 0, 2: 9, 3: 55, 4: 404}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!