ID: 1106181690_1106181694

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1106181690 1106181694
Species Human (GRCh38) Human (GRCh38)
Location 13:27374730-27374752 13:27374773-27374795
Sequence CCTGCCTACTTCTCAGTTTTCTG TGTTTTCCTGATTTCGCTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 449} {0: 1, 1: 1, 2: 53, 3: 239, 4: 609}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!