ID: 1106228272_1106228274

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1106228272 1106228274
Species Human (GRCh38) Human (GRCh38)
Location 13:27801451-27801473 13:27801469-27801491
Sequence CCTGCACAGGATTGTGAACAGAG CAGAGCATGGAGAAGTATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 178} {0: 1, 1: 0, 2: 0, 3: 22, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!