ID: 1106246436_1106246440

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1106246436 1106246440
Species Human (GRCh38) Human (GRCh38)
Location 13:27954068-27954090 13:27954084-27954106
Sequence CCAGACGCCGGAGGCCGCGGGCG GCGGGCGGCTGCAGCTTTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 133} {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!