ID: 1106248576_1106248584

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1106248576 1106248584
Species Human (GRCh38) Human (GRCh38)
Location 13:27967874-27967896 13:27967919-27967941
Sequence CCTTCTTCCCAGCGACAGCAGCT GTACCTTGAATTGGCCCGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 259} {0: 1, 1: 0, 2: 0, 3: 1, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!