ID: 1106269364_1106269371

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1106269364 1106269371
Species Human (GRCh38) Human (GRCh38)
Location 13:28138713-28138735 13:28138732-28138754
Sequence CCTCGCTGGCGGCGGCGGTGGCG GGCGGTGGTGGCCCCGCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 30, 3: 189, 4: 547} {0: 1, 1: 0, 2: 0, 3: 40, 4: 475}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!