ID: 1106303490_1106303496

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1106303490 1106303496
Species Human (GRCh38) Human (GRCh38)
Location 13:28490420-28490442 13:28490439-28490461
Sequence CCTTAATGAACCCCCCTGCAGCC AGCCCCGTGAGCTAAGTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115} {0: 1, 1: 0, 2: 0, 3: 9, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!