ID: 1106305112_1106305117

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1106305112 1106305117
Species Human (GRCh38) Human (GRCh38)
Location 13:28502811-28502833 13:28502841-28502863
Sequence CCTTTAAAAATCCCTTTTCTTCT ATTTATTTGAAAATGATGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 85, 4: 828} {0: 1, 1: 1, 2: 7, 3: 57, 4: 561}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!