ID: 1106305114_1106305117

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1106305114 1106305117
Species Human (GRCh38) Human (GRCh38)
Location 13:28502823-28502845 13:28502841-28502863
Sequence CCTTTTCTTCTCCATGTTATTTA ATTTATTTGAAAATGATGGCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 86, 4: 758} {0: 1, 1: 1, 2: 7, 3: 57, 4: 561}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!