ID: 1106308961_1106308965

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1106308961 1106308965
Species Human (GRCh38) Human (GRCh38)
Location 13:28535866-28535888 13:28535894-28535916
Sequence CCTCCTCTCTGCTTAGAGCAGCA CTGGAGGACCAGCAGCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 99, 3: 175, 4: 443} {0: 1, 1: 1, 2: 23, 3: 155, 4: 714}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!