ID: 1106314407_1106314416

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1106314407 1106314416
Species Human (GRCh38) Human (GRCh38)
Location 13:28580437-28580459 13:28580459-28580481
Sequence CCCAGGGACTCCTAGGGAATCCA ATGAATTGGTTTGGGGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 144} {0: 1, 1: 0, 2: 3, 3: 32, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!