ID: 1106351024_1106351034

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1106351024 1106351034
Species Human (GRCh38) Human (GRCh38)
Location 13:28930792-28930814 13:28930838-28930860
Sequence CCCCAGCACACCAGAGGGAGGAC TGTTACGTATAGGATTTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 245} {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!