ID: 1106378893_1106378901

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1106378893 1106378901
Species Human (GRCh38) Human (GRCh38)
Location 13:29216655-29216677 13:29216701-29216723
Sequence CCACCCTGCTTCTGCTCACCCTG CCAGTCCCAATGTGATGAACCGG
Strand - +
Off-target summary {0: 1, 1: 147, 2: 425, 3: 820, 4: 1413} {0: 2, 1: 159, 2: 424, 3: 390, 4: 394}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!