ID: 1106388070_1106388073

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1106388070 1106388073
Species Human (GRCh38) Human (GRCh38)
Location 13:29307535-29307557 13:29307548-29307570
Sequence CCAAATATGATGACATCAAGAAG CATCAAGAAGGTGGTAAAGCAGG
Strand - +
Off-target summary {0: 10, 1: 16, 2: 16, 3: 43, 4: 339} {0: 2, 1: 7, 2: 19, 3: 39, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!