|
Left Crispr |
Right Crispr |
Crispr ID |
1106392051 |
1106392055 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:29344514-29344536
|
13:29344562-29344584
|
Sequence |
CCCTCTACCTTAAGTTTATGTGA |
TCTTGAAGAGAGCAGATACTTGG |
Strand |
- |
+ |
Off-target summary |
{0: 6, 1: 331, 2: 463, 3: 348, 4: 397} |
{0: 6, 1: 150, 2: 298, 3: 533, 4: 1110} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|