ID: 1106392051_1106392055

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1106392051 1106392055
Species Human (GRCh38) Human (GRCh38)
Location 13:29344514-29344536 13:29344562-29344584
Sequence CCCTCTACCTTAAGTTTATGTGA TCTTGAAGAGAGCAGATACTTGG
Strand - +
Off-target summary {0: 6, 1: 331, 2: 463, 3: 348, 4: 397} {0: 6, 1: 150, 2: 298, 3: 533, 4: 1110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!