ID: 1106403496_1106403503

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1106403496 1106403503
Species Human (GRCh38) Human (GRCh38)
Location 13:29452826-29452848 13:29452867-29452889
Sequence CCCCTAAGTCACCCTGGGGACAA GTCAGCTGCCTCCACTGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 93} {0: 1, 1: 0, 2: 2, 3: 9, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!