ID: 1106409508_1106409519

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1106409508 1106409519
Species Human (GRCh38) Human (GRCh38)
Location 13:29501431-29501453 13:29501476-29501498
Sequence CCTCCTGCAGCACTGGGAGGGGA TTAGGAGAGGAGGGCCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 519} {0: 1, 1: 0, 2: 2, 3: 24, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!