ID: 1106410002_1106410014

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1106410002 1106410014
Species Human (GRCh38) Human (GRCh38)
Location 13:29504954-29504976 13:29504999-29505021
Sequence CCCTGGCCCTAGGATGAGTCCAC GCATCTCCAGCCAACCTCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 103} {0: 1, 1: 0, 2: 0, 3: 26, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!